TotalSaq: Antibody-oligonucleotide conjugates

Conjugation of antibodies to oligonucleotides has many applications, from their potential utility as adjuvants or targeted drug delivery systems, to the recently published simultaneous protein and RNA quantification in single cells, these reagents are opening new avenues to enable researchers move forward the frontiers of science.

A recent publication by Stoeckius et al. used antibodies coupled with oligonucleotides to simultaneously measure proteins and RNA at a single cell level. The method, termed cellular indexing of transcriptomes and epitopes by sequencing (CITE-seq), combines highly multiplexed protein marker detection with unbiased transcriptome profiling for thousands of single cells. The authors also report that the method is compatible with two high-throughput scRNA-seq platforms, Drop-seq and 10X Genomics. A similar approach was used by Peterson et al., they termed their workflow RNA expression and protein sequencing assay (REAP-seq).

Summary of TotalSeq™ formats:

	TotalSeq™-A	TotalSeq™-B	TotalSeq™-C
10x Genomics compatibility	Single Cell Gene Expression Solution (3’, v2 and v3) and any system employing the poly-A tail capture method	Single Cell Gene Expression Solution (3’, v3) with Feature Barcoding Technology and 10x Genomics Data Analysis Software¹	Single Cell Immune Profiling Solution (5’) with Feature Barcoding technology and 10x Genomics Data Analysis Software¹
PCR handle	CCTTGGCACCCGAGAATTCCA	GTGACTGGAGTTCAGACGTGTGCTCTTCCGATCTNNNNNNNNNN²	CGGAGATGTGTATAAGAGACAGNNNNNNNNNN
Capture sequence	Poly-A [(A)₃₀AA³]	NNNNNNNNNGCTTTAAGGCCGGTCCTAGCAA	NNNNNNNNNCCCATATAAGAAA
Next Generation Sequencing compatibility	Compatible with Illumina instruments	Compatible with Illumina instruments	Compatible with Illumina instruments

Fig 1. Diagram illustrating CITE-seq workflow. Step 2 can be performed by Drop-seq (depicted in the figure), or another compatible method such as 10X Genomics platform.